Skip to main content
UCSC In-Silico PCR
 
Assembly:
Aug. 2011 (Broad/latCha1)


 



About In-Silico PCR
  In-Silico PCR V39x1 searches a sequence database with a pair of PCR primers, using the BLAT index for fast performance. See an example video on our YouTube channel.
  • This tool is not guaranteed to find absolutely all off-target locations, it is optimized for targets with higher identities. For use in primer design, especially in repetitive regions, consider additional validation with tools such as primer blast.
  • If you are looking for matches to RT-PCR primers, where primers often straddle intron-exon boundaries, change the Target option and select a gene transcript set. This feature is only available for human and mouse assemblies.

Configuration Options

Genome and Assembly - The sequence database to search.
Target - If available, choose to query transcribed sequences.
Forward Primer - Must be at least 15 bases in length.
Reverse Primer - On the opposite strand from the forward primer. Minimum length of 15 bases.
Max Product Size - Maximum size of amplified region.
Min Perfect Match - Number of bases that match exactly on 3' end of primers. Minimum match size is 15.
Min Good Match - Number of bases on 3' end of primers where at least 2 out of 3 bases match.
Flip Reverse Primer - Invert the sequence order of the reverse primer and complement it.
Append to existing PCR result - Add this PCR result list to the currently existing track of PCR results.

Output

When successful, the search returns a sequence output file in fasta format containing all sequence in the database that lie between and include the primer pair. The fasta header describes the region in the database and the primers. The fasta body is capitalized in areas where the primer sequence matches the database sequence and in lower-case elsewhere. Here is an example from human:
>chr22:31000551+31001000  TAACAGATTGATGATGCATGAAATGGG CCCATGAGTGGCTCCTAAAGCAGCTGC
TtACAGATTGATGATGCATGAAATGGGgggtggccaggggtggggggtga
gactgcagagaaaggcagggctggttcataacaagctttgtgcgtcccaa
tatgacagctgaagttttccaggggctgatggtgagccagtgagggtaag
tacacagaacatcctagagaaaccctcattccttaaagattaaaaataaa
gacttgctgtctgtaagggattggattatcctatttgagaaattctgtta
tccagaatggcttaccccacaatgctgaaaagtgtgtaccgtaatctcaa
agcaagctcctcctcagacagagaaacaccagccgtcacaggaagcaaag
aaattggcttcacttttaaggtgaatccagaacccagatgtcagagctcc
aagcactttgctctcagctccacGCAGCTGCTTTAGGAGCCACTCATGaG
The + between the coordinates in the fasta header indicates this is on the positive strand.

Author

In-Silico PCR was written by Jim Kent. Interactive use on this web server is free to all. Sources and executables to run batch jobs on your own server are available free for academic, personal, and non-profit purposes. Non-exclusive commercial licenses are also available. Contact Jim for details.