Skip to main content
CRISPR Detection Track Settings
 
CRISPR Detection Guides   (All Mapping and Sequencing tracks)

Display mode:      Duplicate track

Alignment Gap/Insertion Display Options Help on display options
Draw double horizontal lines when both genome and query have an insertion
Draw a vertical purple line for an insertion at the beginning or end of the
query, orange for insertion in the middle of the query


Display data as a density graph:

Display data as a rearrangement graph:
Data schema/format description and download
Assembly: SARS-CoV-2 Jan. 2020 (NC_045512.2)
Data last updated at UCSC: 2020-03-27

Description

This track shows the locations of CRISPR detection guides and flanking primers. There are three studies on this topic, with the one by Mammoth Biosciences the most advanced. The Broad Institute's guides were validated, the NYU guides are predictions for now.

Prefix Institution Overview Links
Mammoth Mammoth Biosciences

There are three guides in the set, two are shown on the genome. The third guide detects human RNAseP, as a sample control. Target sequence: TAATTTCTACTAAGTGTAGATAATTACTTGGGTGTGACCCT

Protocol and preprint.
Broad Sabeti Lab, Broad Institute Various guides are predicted, the one shown here is from the protocol. Protocol from Mar 21 2020, Guide website and preprint.
NYU Sanjana Lab, New York University These are predictions by a new algorithm. Shown is the prediction with the highest score. Website

Methods

Sequences were mapped with BLAT.

Credits

Thanks to the labs for producing this work, as well as Kiley Charbonneau for pointing us to the papers.