Skip to main content
Ebola virus BLAT Search
 

BLAT Search Genome

Assembly: 
Sierra Leone 2014 (G3683/KM034562.1/eboVir3)
Paste in a query sequence to find its location in the genome. Multiple sequences may be searched if separated by lines starting with '>' followed by the sequence name.

File Upload: Rather than pasting a sequence, you can choose to upload a text file containing the sequence.

Only DNA sequences of 25,000 or fewer bases and protein or translated sequence of 10,000 or fewer letters will be processed. Up to 25 sequences can be submitted at the same time. The total limit for multiple sequence submissions is 50,000 bases or 25,000 letters.
A valid example is GTCCTCGGAACCAGGACCTCGGCGTGGCCTAGCG (human SOD1).

The Search all checkbox allows you to search all genomes at the same time. Search all is only available for default assemblies and attached hubs with dedicated BLAT servers. The new dynamic BLAT servers are not supported, and they are noted as skipped in the output. See our BLAT All FAQ for more information.

The All Results checkbox disables minimum matches filtering so all results are seen. For example, with a human dna search, 20 is minimum matches required, based on the genome size, to filter out lower-quality results. This checkbox can be useful with short queries and with the tiny genomes of microorganisms.

If you are interested in programmatic BLAT use, see our BLAT FAQ.

For locating PCR primers, use In-Silico PCR for best results instead of BLAT. To search for short sequences < 20bp only in the sequence shown on the Genome Browser, use our Short Sequence Match track. If you are using the command line and want to search the entire genome, try our command line tool findMotifs, from the utilities download page.


About BLAT
 

BLAT on DNA is designed to quickly find sequences of 95% and greater similarity of length 25 bases or more. It may miss more divergent or shorter sequence alignments. It will find perfect sequence matches of 20 bases. BLAT on proteins finds sequences of 80% and greater similarity of length 20 amino acids or more. In practice DNA BLAT works well on primates, and protein BLAT on land vertebrates.

BLAT is not BLAST. DNA BLAT works by keeping an index of the entire genome in memory. The index consists of all overlapping 11-mers stepping by 5 except for those heavily involved in repeats. The index takes up about 2 gigabytes of RAM. RAM can be further reduced to less than 1 GB by increasing step size to 11. The genome itself is not kept in memory, allowing BLAT to deliver high performance on a reasonably priced Linux box. The index is used to find areas of probable homology, which are then loaded into memory for a detailed alignment. Protein BLAT works in a similar manner, except with 4-mers rather than 11-mers. The protein index takes a little more than 2 gigabytes.

BLAT was written by Jim Kent. Like most of Jim's software, interactive use on this web server is free to all. Sources and executables to run batch jobs on your own server are available free for academic, personal, and non-profit purposes. Non-exclusive commercial licenses are also available. See the Kent Informatics website for details.

For more information on the graphical version of BLAT, click the Help button on the top menu bar or see the Genome Browser FAQ.

Kent WJ. BLAT - the BLAST-like alignment tool. Genome Res. 2002 Apr;12(4):656-64. PMID: 11932250